Tanvi Sri Sai Penugonda, Shaina Ambashta, Aarushi Deshpande, Yashvi Patel Advisor: Soumya Suresh
BASIS Irvington High School, Fremont CA; Fremont Christian High School, Fremont; Granada High School, Livermore, CA, Aspiring Scholars Directed Research Program, Fremont, CA; Department of Biology
KEYWORDS: Oxidative Stress, Abiotic, GRAS gene, Antioxidant, Post-harvest Physiological Deterioration
Abstract
Oxidative stress in plants develops due to the build-up of reactive oxygen species (ROS). The experiment conducted compares the effect of oxidative stress on Manihot esculenta, also known as the Cassava plant, and Ricinus communis, also known as the Castor Bean plant. The castor bean and cassava plant are invasive and native species, respectively, to Fremont, California. The Cassava plant was used as a food source in the 1500s; the Castor bean can be used to extract oil from its seeds and has unique chemical properties making it useful to biomedical industries, chemical industries, and the production of biodiesel. This makes both the plants important to be characterised extensively for both the public and the industries.
Introduction
Both Cassava and Castor bean plants are prone to oxidative stress. The primary causes of oxidative stress are environmental factors such as pollution, radiation, and droughts. Each form of oxidative stress plays a role in determining a plant\’s ability to adapt or prevent oxidative damage. In order to prevent oxidative damage, plants must respond with an antioxidant mechanism. Along with the effects of oxidative stress, genes were also compared between these two plant species. The experiment aimed to determine which genes were responsible for similar responses to stress.
An experiment was conducted to investigate the different effects the plants would have when exposed to various typical abiotic stressors at a scientific level. The cassava and castor bean plants did well in the drought abiotic stressor. The castor bean died in the cold stress while the cassava was not observed to be affected. Higher H2O2 levels indicate higher oxidative stress, as plants produce H2O2 when stressed. When the fox assay was performed to determine H2O2 levels, the lead and calcium stressed plants resulted in the same amount of H2O2 being released from the plant.
Literature Review
Researchers have attempted to find a solution to reduce post-harvest physiological deterioration (PPD) in Cassava plants, a significant problem in Cassava root harvesting[1]. The cassava plant is found in many countries towards the west. PPD poses an issue for the availability of the cassava plant in locations that are further from the harvest. PPD also negatively impacts the viability of the Cassava plant once delivered to consumers. Many strategies to reduce PPD have not been beneficial because not many of the strategies help reduce the wastage which comes along with the harvesting of the Cassava plant. The study is centered around the idea of reducing PPD long enough for consumers to use the plant. A solution that is being tested in the paper[1] is RNAi inhibition.
“By altering the biosynthesis of antioxidant enzymes and through interfering with the biosynthesis of scopoletin, insights could be gained into the relationships between ROS, scopoletin, and PPD[1]” Essentially, the researchers are attempting to alter the RNA of the cassava plant in order to prevent reactive oxygen species (ROS) from occurring. The research paper provides an alternative way to reduce oxidative stress: the researchers hypothesise that by altering RNA, they can prevent the cassava plant from deteriorating. The RNAi inhibition was successful to some extent, which means it can be used to control the oxidative stress-induced upon the cassava plant. Ultimately, the paper gives an understanding as to how oxidative stress can be controlled in different environments.
A similar conclusion is found in another paper[2] discussing PPD relating to the Cassava plant. PPD occurs in a short time frame, as once the cassava plant is harvested, it only has a 24 to 72-hour window for it to remain in its viable state. The authors report how reactive oxygen species (ROS) may accumulate during the deterioration of the cassava plant, as “peaks of reactive oxygen species (ROS) and increased activity of enzymes that modulate ROS are detected during deterioration”[2] The researchers deduced that PPD causes oxidative stress in the Cassava plant. Their results support their hypothesis. The conclusion of this experiment shows that cassava plant deterioration is dependent on the cultivar, the duration, and the amount of compounds stored in the plants. The Cassava plant is known to have PPD, which makes the plant deteriorate quickly once harvested. The deterioration of the plant causes ROS, which then in turn causes oxidative stress.
Factors of Oxidative Stress
Each species responds differently under stress. In the article “Physiological and Biochemical Responses of four cassava cultivars to drought stress,” an experiment was performed on four Cassava plants with different genotypes under different conditions of droughts ranging from a controlled drought with 80% water available to severe drought with only 20% of water available. In order to test the oxidative damage, four genotypes were observed over one week. The genotypes were RS01, SC124, SC205, and GR4.
Each genotype had a different response to the drought. Typically during stressful situations, plants develop defense mechanisms to survive throughout the changes in their surroundings. Cassava plants are well-known for their ability to tolerate stressful environmental situations. For example, “the mechanisms of cassava resistant to water deficit include stomatal closure, decreased leaf area, the proper maintenance of net photosynthetic rate for prolonged drought, and the ability to explore water from deep soil layers”[2]. The SC124 genotypes presented the best survival techniques by the closure of stomata and reduced photosynthesis. Additionally, the SC124 plant began to shed old leaves but continued to grow throughout the experiment. The drought stress also increased the relative water content in each genotype. Results also showed an increase in relative chlorophyll content during the mild drought conditions but a decrease when the plant was placed in severe drought conditions.
Environmental stresses such as droughts commonly occur due to a lack of rainfall. Observing and understanding how droughts stress plants will explain how plants in dry climate areas adapt to their surroundings. Abiotic stresses are constantly negatively impacting plants. In order to survive, plants must adapt to their new surroundings by making certain changes physiologically, morphologically, biochemically, and molecularly, and environmental factors affect how plants grow and reproduce [3]. The cassava plant typically adapts well when placed in stressful conditions. The castor bean, an invasive plant, endured much oxidative stress when placed in a new environment. This is why the castor bean needs to be characterised, as not only is the castor bean important for consumers and industries, but it is also highly variable, which means the plant has many variations that are used for various purposes.
Different Abiotic Stressors
There are many stressors, including salinity, drought, variation in temperature, and waterlogging[3]. Each environmental change affects how a plant grows and reproduces. When undergoing extreme changes in the environment, plants experience a set of survival methods and techniques.
Salinity is a common environmental stress that plants face throughout the year. The high amounts of salt have a considerable impact on crop production around the globe. In order to hold onto the water, plants close their stomata to prevent the release of water, which also results in a decrease of CO2 in plants.
Droughts occur in many hot and dry environments. Due to an increase in climate change, it is expected that there will be a significant increase in droughts. Droughts result in a reduction of water inside the plant, which prevents cell reproduction, and prevents processes such as respiration and photosynthesis from occurring at a normal rate. Additionally, the leaves begin to dry up, and the stomata close.
Temperature variation can have two very different impacts on plants. When temperature levels increase above average, there can be significant tissue damage and substantial changes to a plant’s metabolism and growth. Most damage occurs at a cellular level causing catastrophic damage at a long term exposure. Low temperatures also have a significant impact on plant growth and reproduction. Plants are typically exposed to low temperatures at some point throughout the year. Plants that endure temperatures lower than freezing point often suffer discoloration, decay, desiccation, and tissue breakdown.
Waterlogging has been a result of the many extreme climate changes in recent years. It affects crop production because it reduces levels of O2 in soils. It also significantly impacts plant metabolism and distribution. Waterlogging affects the plant’s ability to exchange gas with the atmosphere causing an overall decrease in oxygen.
Methods to protect against stress
Antioxidants are used as protection against different methods of stress such as oxidative stress, heavy metal stress in roots, and different fungal stresses like mycorrhiza fungi and mycorrhizae[3]. Based on the three different molecular mechanisms of heavy metal toxicity, the resulting finding was that transition metals caused oxidative injury in plant tissue. Though the transition metals caused oxidative damage and injury, there is not sufficient evidence that the stress could be alleviated by increased amounts of antioxidants, the main reason being that “transition metals initiate hydroxyl radical production, which can not be controlled by antioxidants[3]”.
For example, “Exposure of plants to non-redox reactive metals also resulted in oxidative stress as indicated by lipid peroxidation, H(2)O(2) accumulation, and an oxidative burst[4]”. “Cadmium and some other metals caused a transient depletion of Glutathione (GSH), and an inhibition of antioxidative enzymes, especially of glutathione reductase[4]”. The main antioxidant being tested to react between different types of metals was GSH. The study concluded that it is possible that mycorrhizal fungi provide protection via GSH since higher concentrations of this thiol were found in pure cultures of the fungi than in bare roots.
By using a chemical that uses mechanisms of heavy metal toxicity to stress out castor root and cassava plant roots it will be possible to observe how antioxidants help plants manage stress and how the plants are being protected from physiological damage.
Ascorbic acid (AA) is the antioxidant that migrates oxidative damage related to water stress in plants. Water deficit stress was used on a young plant that is just starting to develop, to see how the growth, physiological status, and how the non-enzymatic antioxidant defense system responds to the lack of water[4]. The study used a drought-tolerant gene and a drought-sensitive gene. “These cassava genotypes were treated with six doses (0.00, 0.25, 0.50, 0.75 and 1.00 mM) of AA before being subjected to water deficit (45.0% field capacity) and a water sufficient AA-untreated control”[5]. The results of this experiment are that “in both genotypes, water stress reduced shoot height (40.3%), leaf area (42.5%), and the number of roots (54.5%), biomass (28.6%), relative water content (RWC, 3.2%) and photosynthetic pigments (300.0%)”[5].
These results show that physiological and regular functions were affected by the lack of water, which is a crucial substance for all living organisms. “However, water stress increased proline (91.3%), endogenous AA (112.0%), catalase (CAT, 300.0%) and superoxide dismutase (SOD, 15.3%) in both genotypes” (Ibrahim, 2019). “Compared with IITA-TMS-IBA010040, leaf area, biomass, number of roots and shoot height of IITA-TMS-IBA980581 were higher by 7.3, 24.6, 25.9 and 13.1%, respectively”[5]. This shows that the drought-tolerant plant can still survive, maintain homeostasis, and grow all during a water shortage. The content of proline of the drought sensitive gene was higher than the drought tolerant gene by a percentage of 14.3%, but pre-treatment with AA improved photosynthetic pigments, growth parameters, endogenous AA, and RWC.
The study concluded that pretreatment of the cassava plants with AA before deprivation of water could alleviate oxidative stress. The experiment also identifies different genes relating to oxidative stress, similarly to this project, except the comparison is on a drought-sensitive versus a drought-tolerant, whereas this research project discusses invasive versus native species of plants.
To figure out where the cassava and castor bean plant are similar, the genetic similarity must be compared. Researchers have attempted to characterise the genetics of the castor bean[7]. The researchers discuss how castor bean has 203 lineages and 5 parents. They decide to experiment using morpho-agronomic characterisation. This form of characterisation is evaluated by the entropy level of the Renyi coefficient, which is used to determine entanglement and quantify diversity in genes.
The results of the study in the paper suggest that the more classes of castor bean there are, and the more balanced the ratio between frequencies, the higher the H (H2O2) value is. The researchers concluded that the highest H value occurs when each class includes 50% of the accessions, or addition to the H value. The researchers report that 22.86% of the castor bean plants which they tested had diverse phenotypic classes contributing to the elevated H value. The results show which genotypes correspond to which phenotypes and what those particular castor bean plants can be used for.
Two experiments were conducted in Brazil to evaluate the genotypes in cassava plants[2]. The experiments were performed during growing seasons 12 months apart. Cassava plants showed genes that associated well with genetic breeding, or were able to reproduce efficiently. Some of the main traits and genes that were observed throughout the experiment were the shoot plant weight, number of roots per plant, number of rotten roots per plant, fresh root yield, harvest index, and starch content. The information presented in this research paper provides some basic knowledge about the Cassava plant, especially the genotypes, that may be able to help understand the plant throughout experimentation.
The hypothesis is that the castor bean will respond poorly to an abiotic stressor that the cassava plant can tolerate. For our experiment, it was determined with reference to the following paper that the GRAS gene would be used to compare the cassava plant and castor bean.
In this study, the researchers predicted that a set of proteins had the GRAS domain and tested this in their research. All but one protein had a GRAS domain with one member. The outlier had two GRAS domains and two members. Using previous research on the GRAS gene, the researchers also mapped the genomic sequence of the GRAS gene in castor beans. “A total of 28 genes were evaluated, with at least 10 reads coverage, and 25 showed nearly identical gene structures to predicted gene models [1].”
Using this information the researchers performed an experiment to see if there is a functional difference between the GRAS gene of different plant species. “To explore the evolutionary relationships within the GRAS gene family, 129 full-length proteins (46 from castor beans, 33 from Arabidopsis, and 50 from rice) were aligned to construct an unrooted tree with 14 distinct subfamilies[1].” They found that a certain family of the GRAS gene contained proteins only from castor beans and that the same subfamily also lacked members of another subfamily. “The other nine subfamilies clustered with members of each species, indicating evolutionary and functional conservation among these subfamily members.[1]”
To test whether there was a difference in the function of the gene between the GRAS genes of the castor bean plant, the level of expression was measured in four different abiotic stress treatments: drought, salt, cold, and heat. The difference in the number of genes that were expressed in each treatment reveals that each of these genes has a different function in different environmental situations. “In this study, we identified and confirmed the gene structure of 48 putative GRAS genes from the current castor bean genome[10].” Placing the plants in abiotic stress treatments can compare the observable responses to stressors and figure out in which areas the plants are similar and in which areas they differ.
Methods
In order to perform two variations of abiotic stress, the cassava and castor bean plants needed to be placed in two different temperatures to imitate extremely hot and extremely cold environments. Five of each species of plants were used. Four out of the five plants received a cold, drought, lead and calcium stress each, and one was the control.
To initiate the stresses, the cassava chutes needed to be transferred into separate pots. All of the plants needed to adapt to the new environment in the lab, so before the 2 week stress, the plants were given 4 days of regular watering so the plants would not react immediately or go into transplant shock.
To mimic the cold temperatures of many arctic regions, the plants were watered using ice instead of room temperature water. The cold plants were watered every other day with 216 mL of water. Additionally they were placed in cold temperatures throughout the entire experiment. The castor bean was small enough to be placed in the fridge which was about 20°C whereas the cassava was too large. Although there was not enough fridge space for the cassava plant, it was placed in a cooler which was filled with multiple beakers with ice. A source of error could be that the cooler temperature was not as constant as the fridge and increased as the ice melted, which may have affected the final result. The second abiotic stress performed on the plants resembled a hot environment with low concentrations of water available. The plants were placed under heat lamps for 12 hours as a replacement for the sun and then kept off for 12 hours to imitate the night time. Regions with high temperatures typically are considered drought areas because of the lack of rain water. The cassava and the castor bean plants were given little to no water on most days of the experiment. These plants were watered with about 52 mL of water every 3 days.
In addition to the abiotic stresses, two chemical stresses were also performed on the plants. The first chemical used to stress the plants was lead (II) nitrate. The amount of chemical used on the individual plants was based on the amount of water given to each plant, so that the concentration of lead (II) nitrate was the same for both plants. The cassava plants were given 250 mL of water with 0.0414 grams of lead (II) nitrate. The amount given to the castor bean was much less because the castor bean only required 50 mL of waters. 0.00828 grams of lead (II) nitrate was diluted in 50 mL of water and given to the castor bean plant. The lead and calcium plants were also watered with 216 mL every other day.
The second chemical stress performed used calcium chloride. The same method used to stress out the plants with lead (II) nitrate was applied to the calcium chloride plants. The cassava plant was given 0.139 grams of calcium chloride with 250 mL of water. The castor bean plant was given 0.00277 grams of calcium chloride with 50 mL of water. To analyse the results from the experiment, Fox Assay, Gel Electrophoresis, PCR and lengthy calculation were performed to help understand what affects the individual stresses had on each of the plants.
Results
To record results from the abiotic stressors, a lab notebook was kept next to the plants to record observations. The person who went to the lab on a specific day was decided by a detailed independent watering schedule planned on google sheets. The lab notebook was used to record observations each day throughout the one week period of abiotic stresses. Surprisingly, the drought plants of both the castor and the cassava species were both still extremely healthy and were growing, even though there was a lack of water. The cold castor bean plant died in the fridge, likely due to the lack of fridge space, but also the extreme cold temperature. The cassava plant was in a much bigger pot which could not fit in the fridge, so a cooler was used, filled with ice, and set to the same temperature as the fridge where that castor bean plant was. The problem with the cooler was that it never stayed at a constant temperature, so this may have affected the stress results drastically. The lead and calcium plants of both species both were stressed visually. The castor bean lead plant was completely shrivelled up and very stressed (Figure 1).
Figure 1: Castor bean with lead stressor compared to castor bean control plant
The fox assay was used to measure the amount of hydrogen peroxide percentage in the plant (Figure 3). The higher the result, the more the plant has been stressed. The hydrogen peroxide percentage was compared to the percentage of the control, which is discussed later.
Another aspect of this project was the genetic comparison between the two species. PCR and gel electrophoresis was performed to visually see the genetic differences (Figure 2). PCR was performed using the cassava forward and the cassava reverse primers, sequenced AGGCTAACCACAACTCTGGC and CTCAGACATGACCTGGTCCG. PCR was used so it would be easier to identify the gene of interest, the GRAS gene.
Figure 2: Castor bean (first 2 columns) and cassava (second 2 columns) compared to DNA ladder of GRAS gene (farthest to the right)
Originally the PCR mix that was supposed to be used was the SuperFi PCR Mastermix. Because this mastermix was not available in the lab at the time, DreamTaq PCR Master Mix was used. This mastermix was more efficient because it did not take as much time when mixed and placed in the thermocycler. The master mix was mixed with the primers, nuclease free water, and the plant juice extracted from the plants at the end of the one week long stresses, which were the drought plants. The mixtures were then placed into small eppendorf tubes, and placed in a thermocycler for three hours for the primers to anneal and for the DNA to make copies of itself.
Once PCR was completed, Gel Electrophoresis needed to be completed to confirm whether PCR was performed successfully, and to visualise the DNA (Figure 2). The PCR tubes were centrifuged and had 6X Tri Track Dye added to them, which makes the DNA more visible. Four of the six wells were loaded up with the DNA, two from the castor bean, and two from the cassava. One of the wells was skipped, and the last well contained the DNA ladder, which was used to compare the genes. It was placed in the chamber for thirty minutes, surrounded by TAE buffer solution. The agarose gel was removed and then ETBR was poured over the gel to stain the DNA and the DNA Ladder, making it easy to see under UV light. It was placed in the fridge for twenty to thirty minutes and was then transferred to the UV light to see the DNA ladder, and the DNA.
The results were relatively clear under the fluorescent light. The DNA ladder had 4-6 bands of different sizes. The DNA ladder was 100 base pairs long and was from Lend Scientific. It contains the base pairs found in the GRAS gene. The DNA ladder most likely represented the target GRAS gene, since it resembled the castor bean plant more (Figure 2). The GRAS gene is originally from the castor bean gene pool, which explains why the castor bean plant DNA matched the DNA ladder more accurately than the cassava, though the cassava gene also contained similarities. The gene naturally was quite long, but it should have been in the electrophoresis chamber a little longer so that the bands could separate a little more.
Conducting fox assay determines the amount of stress applied on each of the plants. Comparing the control plants and the plants which had stressors applied shows whether or not the plants were successfully stressed. The fox assay was conducted by first creating an extraction solution of perchloric acid and mixing it with the plant extracts to create the supernatant. The supernatant was then mixed with the working reagent made of ammonium ferrous sulfate and xylenol orange dye. The mixture was then developed at 30°C for 30 minutes. Then one mL of each of the 10 extractions were placed into cuvettes. The cuvettes were then placed into a spectrophotometer, which showed the H2O2 absorbency. At a time, 2 cuvettes were placed into the machine. The H2O2 absorbencies were recorded, and the equation (2.24 x 105M-1cm-1) to calculate the concentrations was used.
Calculating the H2O2 concentration for each plant provides an exact number to compare (Figure 3). The plant which had the least concentration was the cassava control plant and the one with the highest concentration was the castor bean with the lead. The cassava lead plant, cassava calcium plant, and cassava drought plant all have the same H2O2 concentration. The castor bean lead plant was the only one of the castor bean plants which was successfully stressed. This is because the H2O2 concentration was higher than the castor bean control plant. On the other hand, all of the cassava plants were successfully stressed, as the H2O2 concentrations of each of them were higher than the concentration of the cassava control plant.
|
Type of Stress |
H2O2 concentration (μmol/g) |
|
|
Cassava |
Castor Bean |
|
|
Lead |
2.551 x 10-5 |
-1.701 x 10-4 |
|
Calcium |
-4.677 x 10-5 |
-1.701 x 10-4 |
|
Drought |
-8.078 x 10-5 |
-1.616 x 10-4 |
|
Cold |
-6.378 x 10-5 |
-1.701 x 10-4 |
|
Control |
-3.827 x 10-5 |
-1.871 x 10-4 |
Figure 3: Results from the fox assay: H2O2 Concentrations of Cassava and Castor Bean Plants under different stressors
Discussion
Overall, the results from the abiotic stresses show that the lead nitrate was the most effective at stressing both the castor bean and the cassava plant. The plant which was stressed out the least was the cassava control plant, matching with initial predictions. The cassava lead, calcium and drought plants all had the same amount of H2O2. These results occurred despite the stresses being completely different, with different concentrations and amounts. Another result was that the castor bean control plant was second to most stressed, even though it was not subjected to any type of stressor. This could be an anomaly and could have happened because it was transferred into a new environment, and it was also very limited to space in the lab.
Overall, all of the control plants grew at a steady pace. The calcium and lead stress either reduced growth, or was fatal to the plants. The cold stress had mixed results due to the lack of fridge space and the cooler which did not maintain a constant temperature. The drought stress plants both were the healthiest and showed the most growth overall, even though it was barely watered and was placed under heat lamps.
These results are important, because they show us what the plants can tolerate, and what they can not. These results can also be put into practical use for agriculture, farming and the crop industry, to potentially change growing mechanisms such as their water, making sure it has no lead nitrate, fertilizer and making sure it does not have calcium, and making sure that plants have lots of sunlight. This is a problem in the industry today, as many fertilizers contain lead4. There is potential to do more experimentation in this field, and obtain more results.
The results of the genetic part of this experiment are shown in the agarose gel created with the DNA ladder and the DNA from the castor bean and cassava plant. The GRAS gene controls plant and chute growth. The cassava does resemble the DNA ladder as well, but it does not resemble it as well as the castor bean.
Lastly, some limitations to this experiment will be addressed. It is not fully known whether the cassava plant contains the GRAS gene or not. It is also not known whether a high concentration of calcium, or a low concentration of calcium is toxic to plants. It also will not be known if the cold stress worked for the cassava and castor bean because of the uncertain conditions. These questions could be addressed by further work in this area, for instance by performing more trials of this experiment in the future.
Conclusion
There were a variety of results seen from stressing the casava and castor bean plants using oxidative and chemical stresses. The cassava chutes did not show as much physical damage or change in comparison to the castor bean plant. The cassava and castor bean plants adapted well to the high temperatures and low amounts of water, but were not able to adapt well to the cold temperatures. The fox assay results indicated that some of the plants applied stresses were successful while others were unsuccessful. The extent of the stress was determined by comparing the concentration of H2O2 of the control plants to the plants which had stresses applied. In conclusion, the castor bean plant compared to the cassava plant was more successful in being stressed.
Acknowledgements: We would like to thank Ms. Soumya Suresh for her guidance and support throughout this research period, and also the lab managers and pre-work course teachers.
Present Address: Aspiring Scholars Directed Research Program, 46307 Warm Springs Blvd, Fremont, CA 94539
Author Contributions: All authors contributed to the writing and revising of this paper.
Notes: This work was conducted over a one-month period.
References
1. Hasanuzzaman M., Hossain M. A., Teixeira da Silva J. A., et al. (2012, January). Plant Response and Tolerance to Abiotic Oxidative Stress: Antioxidant Defense Is a Key Factor. Springer, Dordrecht. https://doi.org/10.1007/978-94-007-2220-0_8
2. Reilly, K., Gómez-Vásquez, R., Buschmann, H., Tohme, J., & Beeching, J. R. (2004). Oxidative stress responses during cassava post-harvest physiological deterioration. Plant molecular biology, 56(4), 625–641. https://doi.org/10.1007/s11103-005-2271-6
3. Liu, S., Zainuddin, I. M., Vanderschuren, H., Doughty, J., & Beeching, J. R. (2017). RNAi inhibition of feruloyl CoA 6\’-hydroxylase reduces scopoletin biosynthesis and post-harvest physiological deterioration in cassava (Manihot esculenta Crantz) storage roots. Plant molecular biology, 94(1-2), 185–195. https://doi.org/10.1007/s11103-017-0602-z
4. Schützendübel, A. (2015). Plant Responses to Abiotic Stresses: Heavy Metal-Induced Oxidative Stress and Protection by Mycorrhization. PubMed. https://pubmed.ncbi.nlm.nih.gov/119 97381/
5. Ibrahim, O. R. (2019, September 27). Pre-treatment of two contrasting water-stressed genotypes of cassava (Manihot esculenta Crantz) with ascorbic acid. I. Growth, physiological and antioxidant responses. Physiology and Molecular Biology of Plants. https://link.springer.com/article/10.1007/s12298-019-00709-w
6. Silva R. S., Moura E. F., Neto J. T. F., et al. (2016 July). Genetic parameters and agronomic evaluation of cassava genotypes. SciELO. https://doi.org/10.1590/S0100-204X2016000700006
7. Silva, A., Silva, S., Santos, L., Souza, D., Araujo, G., Dantas, J., . . . Dantas, A. (n.d.). Characterization and performance of castor bean lineages and parents at the UFRB germplasm bank. Retrieved July 10, 2020, from https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0209335
8. Uarrota, V. G. (2015, November 5). Metabolomic, Enzymatic, and Histochemical Analyzes of Cassava Roots During Postharvest Physiological Deterioration. PubMed. https://pubmed.ncbi.nlm.nih.gov/265 41143/
9. Xu, W., Chen, Z., Ahmed, N., Han, B., Cui, Q., & Liu, A. (2016, June 24). Genome-Wide Identification, Evolutionary Analysis, and Stress Responses of the GRAS Gene Family in Castor Beans. Retrieved July 10, 2020, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4964380/
10. Zhu, Y., Luo, X., Nawaz, G. et al. (2020, April 24). Physiological and Biochemical Responses of four cassava cultivars to drought stress. Scientific Reports. doi.org/10.1038/s41598-020-63809-8
About the Authors
We are students from different high schools who have never met before. All of us were interested in research and wanted to experience life in a research laboratory. United by persistence, determination and several obstacles along the way, the 4 of us were able to successfully accomplish studying the genetic comparison and oxidative stress of the cassava and castor bean plant.