Ayush Naveen Bhat, 12th Grade, ISP School, Panama City, Panama
Govindaraju M, Molecular Biophysics, Indian Institute of Science, Bangalore, India
Jagadeesh Kumar D, Department of Biotechnology, Sir M. Visvesvaraya Institute of Technology, Bangalore 562157, India
Corresponding author: Ayush Naveen Bhat ([email protected])
Keywords: Copper; DNA; Stability; Alzheimer’s disease
Abstract
The conformation and stability of DNA is crucial for the body to maintain metabolic homeostasis and carry out some of the crucial processes such as protein synthesis and DNA repair mechanisms – fixing the damaged bases by replacing them with nucleic acids. Copper (Cu) is an etiological pathway involved in Alzheimer’s biology. In a normal brain, DNA is right-handed B-DNA and in an Alzheimer patient\’s brain, DNA is in a Z-DNA form, but the mechanism of this transition is not clear. We are investigating and understanding the role Cu plays in changing B-DNA to Z-DNA. The purpose of this investigation is to analyze the interaction of Cu with a fragment of synthesized DNA (GCA ATC TAA TCC CTA) used as a model for when it is in a B-DNA form. The studies showed that Cu causes B-DNA to change into an altered version of B-DNA.The interaction between Cu and the DNA was also visualized through molecular docking where Cu formed hydrogen bonds during its interaction with the DNA fragment. The screenshots from the modelling program showed the location where Cu binds with three of the nitrogenous bases of DNA (guanine, adenine, and cytosine) which modifies the DNA conformation hence resulting in the conformational change of DNA.
Introduction
Copper (Cu) is the key factor for the development of Alzheimer’s disease (AD). It is an essential metal in the human body with only 50-120 milligrams present in a healthy body [1]. Copper levels in a normal aging brain’s hippocampus and frontal cortex is 0.1 micromol/g but in an Alzheimer patient’s brain Cu levels are inconsistent (in moderate AD it is lower by 0.02 micromol/g, in severe it is lower by 0.08 micromol/g and in the control group it is lower by 0.1 micromol/g [3]). Moreover, the Cu level is lower in the adipose-tissue-specific secretory factor (ADSF) compared to normal cerebrospinal fluid (CSF) [3]. Cu is responsible for the formation of collagen which is the most abundant protein in the body that helps in repairing damaged tissues, provides structure and strength, and acts as a protective layer of proteins for organs such as the liver [1]. Cu also aids in the synthesis of Adenosine Triphosphate (ATP) which is used as energy in the metabolic activity of the human body [1]. However, excessive amounts of concentrated Cu can lead to serious damage in DNA as it is likely to bind to 3 of the nitrogenous bases (adenine, guanine, and cytosine) in the DNA. During the binding of the Cu atom between the two DNA strands, there is a change in the conformation leading to breaks in the perfect helical structure of DNA [4].
The purpose of this article is to document and analyze the effects of introducing Cu into DNA conformation. DNA or deoxyribonucleic acid is one of the most highly studied nucleic acids and it is the genetic code that differentiates each human being. DNA carries the genetic code that gives us our unique characteristics [11]. There are three main types of DNA – A, B, and Z [5]. These types of DNA have different properties and exhibit different conformations [5]. Some of these differences include the width between the two strands of DNA, the difference in the shape of the minor and major grooves, and their helical turn, with Z-DNA having a left-handed turn while A and B-DNA have right-handed turns [5]. A synthetic form of the DNA sequence GCA ATC TAA TCC CTA was used in this study as it reflects a human genome. The use of a whole-genome would show overall interactions, so a definitive DNA segment was used to understand a specific interaction. Three different types of equipment and techniques were used in this study: a circular dichroism (CD) spectrophotometer, an ultraviolet (UV) spectrophotometer, and a fluorescent spectrophotometer.
Materials and Method
Repeats
GCA ATC TAA TCC CTA sequence was purchased from MWG Biotech GmbH and dissolved with MilliQ water. 5mM of Tris-HCl (pH of 7.4) buffer was used for further dilutions and to provide a stable pH for the circular dichroism (CD), fluorescence, and UV studies.
Copper Chloride (CuCl2 • 2H2O)
High-quality copper chloride was purchased from Merck Schuchard and used in this experiment. A Stock solution (1 mM) of this was prepared with MilliQ water and was utilized to understand the conformational change of the DNA due to its interaction with copper. There were 5 main concentrations used: 25, 50, 100, 250, and 500 µM.
Spectrophotometer
Jasco V-530 and Jasco J-715 spectrophotometer were used in this study. These devices emit a beam of light that passes through a glass chamber that contains the specimen through which the absorbance of light emitted by the sample is measured.
Circular Dichroism (CD) Studies
CD studies were used to evaluate the effect of Cu on conformational change in DNA which was recorded by the Jasco J-715 spectropolarimeter at 25◦C. Quartz cuvettes of 1mm path length held the sample which was used to obtain the CD spectra within the wavelength of 190 nm to 320 nm including the sampling interval every 1 nm. Four repeated scans were recorded for each Cu concentration and a control group with no Cu present.
UV absorption studies
The electronic absorption and the binding ability of Cu to GCA ATC TAA TCC CTA was explored through the Jasco V-530 spectrophotometer with a temperature controller which allowed all samples to be kept at the same temperature. The objective of the study is to measure the absorption of UV light by the DNA as the copper concentration is increased.
Fluorescence Studies
The binding of Cu to the DNA was measured as it replaced EtBr (Ethidium Bromide) that was bound to GCA ATC TAA TCC CTA and evaluated the effect of Cu as an intercalating agent. This was explored through the spectrophotometer. In this study, DNA will be exposed to fluorescent light and the absorption of the fluorescent light will be measured in relation to the increase in copper concentration.
Molecular Docking Studies
Molecular docking was carried out to understand the nucleotide interactions between Cu and the DNA. A substitute fragment was tested with the same properties as the original fragment due to limitations in fragment length. The selected target DNA sequence B chain TTCCTATTGCGCAATCCAGTT and D chain AAACTGGATTGCGCAATAGG have a consensus DNA site (ATTCGC). The ligands and target DNA were minimized by using CHARMm force filled with potential energy (kcal/mol) of -4147.69356.
Docking was carried out using CDOCKER protocol in Discovery Studio 3.5, a CHARMm-based molecular dynamics (MD) simulated-annealing-based algorithm (based on bond energies), and a conventional molecular mechanics force field was used to analyze the docking [6]. The CHARMm-based molecular dynamics (MD) scheme was used to dock ligands into a receptor binding site. Random ligand conformations were generated using high-temperature MD. The conformations are then translated into the binding site. Possible ligand conformations are then created using random rigid-body rotations followed by simulated annealing and to arrive at a conclusion as to which of these conformations is the most suitable. A final minimization is then used to refine the ligand poses.
While DNA is kept rigid, Cu is treated as fully flexible and a final minimization step is used to refine the docked poses. Thus, the optimized structure of the Cu is displayed in Figure 1.
Results
UV Studies:
In the UV experiment, the DNA damage can be clearly seen as a result of the introduction of copper. In Table 1 as the concentration of Cu is increased from 0 to 250 μM, the intensity in UV increases from 0.359 to 1.056. This increase in intensity is known as hyperchromism. When the Cu ion binds to DNA through hydrogen bonding, it opens up the double-stranded DNA, exposing some of the nitrogenous bases present in the nucleotides. The DNA fragment then starts to denature, and the bases start to stack up which increases the absorption of UV light compared to the normal double-stranded DNA without any interactions with Cu. This supports our prediction showing that as the concentration of Cu is increased, the DNA denaturation increases and causes a hyperchromic shift, increasing the absorption by the DNA fragment [4].
Table 1: Average UV Values absorbed as Cu Concentration is Increased
|
Cu Concentration |
Peak 1 Wavelength/UV intensity |
|
DNA Only |
Wavelength: 261.8 nm UV value: 0.359 |
|
DNA + 50 μM |
Wavelength: 260.0 nm UV value: 0.444 |
|
DNA + 100 μM |
Wavelength: 258.2 nm UV value: 0.521 |
|
DNA + 250 μM |
Wavelength: 249.4 nm UV value: 1.056 |
Fluorescent Studies
In the fluorescent experiment, the DNA damage in Table 2 as the concentration of Cu is increased from 0 to 500 μM can be clearly seen. In the fluorescent spectra, only one peak is observed, which is positive. Unlike the UV spectra, a decrease in the intensity of the spectra is observed. This is because when Cu binds to the DNA, the double helix starts to coil, making it tighter and more compact. In this investigation, Ethidium Bromide (EtBr) is used to visualize the DNA binding pattern by the fluorescence machine. If EtBr was not added and a sample was recorded, the spectra would be absent as the DNA would be hidden. When Cu is added to the different concentrations, Cu competes with EtBr. Like Cu, EtBr also binds to DNA and when Cu is added it competes to obtain the same place as EtBr. EtBr and Cu are examples of intercalating agents that bind in between the double helix. So as the concentration of Cu binding to DNA increases the concentration of EtBr binding to DNA decreases. So, as shown in Table 2, the absorption intensity decreases from 174.61 to only 144.00 which represents the damage caused to the DNA fragment [4].
Table 2: Average Fluorescent Values as Cu Concentration is Increased
|
Cu Concentration |
Peak 1 Wavelength/ Fluorescent intensity |
|
DNA only |
Wavelength: 595 nm Fluorescent value: 174.61 |
|
DNA + 25 μM |
Wavelength: 596 nm Fluorescent value: 169.80 |
|
DNA + 50 μM |
Wavelength: 596 nm Fluorescent value:164.00 |
|
DNA + 100 μM |
Wavelength: 596 nm Fluorescent value: 160.00 |
|
DNA + 250 μM |
Wavelength: 595 nm Fluorescent value: 154.00 |
|
DNA + 500 μM |
Wavelength: 596 nm Fluorescent value: 144.00 |
CD studies:
In the CD spectra, the DNA conformation in Table 3 as the concentration of Cu is increased from 0 to 500 μM can be clearly seen. Like the fluorescent study, even the CD spectra show a decrease in intensity and this is due to the same reason as in the fluorescent study, that as Cu concentration increases, the double stranded DNA coils up more to make space for the Cu metal causing less absorption of light and thus decreasing intensity. There is also another important factor regarding the shift in wavelength. In some instances, for example, from 0 Cu concentration to 100 μM Cu concentration in the first peak, the wavelength has increased from 269 nm to 270 nm and whenever there is an increase in wavelength this is known as a hyperchromic shift. Again, from 0 Cu concentration to 100 μM in the 4th peak, a decrease in wavelength from 207.4 nm to 207.0 nm can be seen. This is known as a hypochromic shift since there is a decrease in wavelength [4].
Table 3: Average CD Values on Each of the 4 Peaks as Cu Concentration is Increased
|
Cu Concentration |
Peak 1 Wavelength/ CD intensity |
Peak 2 Wavelength/ CD intensity |
Peak 3 Wavelength/ CD intensity |
Peak 4 Wavelength/ CD intensity |
|
DNA only |
Wavelength: 269.0 nm CD value: 4.424 |
Wavelength: 246.6 nm CD value: -3.469 |
Wavelength: 218.4 nm CD value: 4.594 |
Wavelength: 207.4 nm CD value: 0.114 |
|
DNA + 100 μM |
Wavelength: 270.0 nm CD value: 3.493 |
Wavelength: 247.4 nm CD value: -2.410 |
Wavelength: 218.6 nm CD value: 3.700 |
Wavelength: 207.0 nm CD value: 0.272 |
|
DNA + 250 μM |
Wavelength: 271.2 nm CD value: 2.979 |
Wavelength: 248.2 nm CD value: -1.398 |
Wavelength: 219.2 nm CD value: 3.352 |
Wavelength: 207.2 nm CD value: 0.999 |
|
DNA + 500 μM |
Wavelength: 272.8 nm CD value: 2.535 |
Wavelength: 250.6 nm CD value: -1.469 |
Wavelength: 220.4 nm CD value: 2.490 |
Wavelength: 208.0 nm CD value: 0.310 |
Docking Studies:
The result of molecular docking analysis of DNA with Cu was evaluated and presented in Figure.1A-C and in Table 4. As indicated in the Fig 1A-C, Cu interacts with DNA nucleotides, through Cytosine2 of B Chain; Guanine-2 of D Chain; and Cytosine-1of D Chain. This forms a strong covalent metal-adenine–Cytosine complexes, where the Cu atoms are bridged by guanine ligands coordinated via N(1) and N(7), however, Cu(II) ions prefer interaction with N7 and O6. The Cu (II)–N7 bond lengths were in the range of 2.340 Å and Cu (II)-N3 in the range of 2.846 Å and the Cu (II)–O6 in the range of 2.294Å. Similarly, the structural overlay analysis of native DNA and docked Cu bound DNA nucleotide bases displays the minor orientation of nucleotide base pairs and significant rotations across the atoms (Native DNA nucleotide carbons are shown in black color, while Cu bound DNA nucleotide carbons are in green color). This shows the movement of the nucleotide bases due to the introduction of copper. The base stacking pattern (figure 1c) of Bound (Green) and Unbound forms of DNA helices (black) indicate that the shift in the position upon binding of the Cu represent the changes in the altered B-DNA conformations. Thus, results of the interactions that are presented in Figure 1c and Table 4 indicate that the bond distance between 2 nucleotides decreases upon binding to Cu. This indicates a greater strength of interaction, leading to the change in the conformation of DNA.
Therefore, docking studies results confirm strong binding of Cu ligands in the major groove of DNA via formation of hydrogen bond and hydrophobic bond with docking score of −65.4785 kcal/mol leading to probable changes in the DNA conformation and breakage.
Table 4: Interaction Cu and DNA
|
PDB ID |
DNA CHAIN native |
Nucleotide Atoms |
Normal Bond distance in Å from Cu binding region |
DNA CHAIN with Cu_(II)_ION docking |
Nucleotide Atoms (Donor atom: Acceptor atom) |
Bond distance in Å from Cu(II)ION |
Highest -CDOCKER energy (kcal·mol−1 ) |
highest -CDOCKER interaction energy (kcal·mol−1 ) |
|
1NWQ |
B Chain : Cytosine-2 |
DC-2:N4 |
3.326 |
B Chain : Cytosine-2 |
DC-2- Cu (II):N367 |
2.846 |
26.9927 |
26.7025 |
|
D Chain: Guanine -2 |
DG-2:O6 |
3.047 |
D Chain: Guanine-2 |
DG-2-Cu (II) :N1003 |
2.294 |
|||
|
D Chain: Guanine-2 |
DG-2- N7 |
1.760 |
D Chain: Guanine-2 |
DG-2 – Cu (II) :N7 |
2.340 |
|||
|
D Chain: Cytosine -1 |
DC-1-N4 |
3.832 |
D Chain: Cytosine -1 |
DC-1-Cu (II): N1035 |
2.122 |
Figure 1: [A] DNA Interactions with Cu. [B] Zoomed view of Cu Interactions with DNA. [C] Zoomed Superposition of native and Cu Bound DNA and orientation of the nucleotide bases.
Discussion
B-DNA is the normal and most common conformation of DNA in cells that allow the body to carry out several biological functions [5]. Alzheimer’s is a disease where the brain is affected leading to memory and behavior problems [3]. Alzheimer’s can be a result of a change in the conformation of DNA and Cu is one of the etiological factors that lead to Alzheimer’s pathology [4]. Even though Cu is an essential mineral for the functioning of our central nervous system, high amounts of exposure can lead to a change in DNA conformation [3]. Through this study, it has been demonstrated with evidence that increasing Cu concentrations on DNA fragment GCA ATC TAA TCC CTA causes a change in the intensity of the peaks in Tables 1-3 which is evidence for a change in conformation that may have relevance to neurodegeneration.
Copper, the etiological factor that binds to DNA has an affinity to the nitrogenous bases that make up DNA [8]. Cu has a strong affinity to the guanine and cytosine bases resulting in hydrogen bonds being formed. Cu causes a change in the conformation of the DNA helix by causing one of the bases to rotate around its glycosidic bond linkage causing an unwinding of the DNA double helix [8]. This unwinding causes DNA to shift from its regular B-DNA conformation into a modified B-DNA conformation that is said to cause neurodegenerative diseases such as Alzheimer’s [7].
Conclusion:
The aim of this investigation was to demonstrate the relationship between Cu and the DNA and how increasing concentrations of Cu exposed to DNA could result in DNA damage and conformation change which may eventually lead to neurological disorders. In addition, through computational studies, it is evident how these two substances form hydrogen bonds with the DNA’s nitrogenous bases causing the DNA molecule to change conformation which will result in DNA damage. Earlier studies showed that the normal human brain has B-DNA while a brain with Alzheimer’s has Z-DNA [9]. The present study showed that disease causing factors like Cu changed B-DNA form into modified B-DNA leading to Z-DNA. This provides evidence that Cu induces the change in DNA conformation [6].
Funding statements and acknowledgements.
This project was funded through a scholarship provided by Kosagi Foundation-INDICASAT-Panama. The idea was conceived by me and was developed and guided by my mentor Dr Jagannatha Rao, Director of Indicasat, Panama. The entire project was overseen by Dr. Govindaraju from the Indian Institute of Science (IISc) and Dr. Jagadish from Visvesvaraya Technological University (VTU). This experiment took approximately 2 weeks and the process of writing this research paper took approximately 2 months.
References:
[1] “Copper Essential for Human Health.” European Copper Institute, European Copper Institute, www.copperalliance.org.uk/knowledge-base/education/education-resources/copper-essential-human-health/.
[2] Gallagher J. “Copper Linked to Alzheimer\’s Disease.” BBC News, BBC, 20 Aug. 2013, www.bbc.com/news/health-23755037.
[3] Rao, Jagannatha, et al. “Trace Elements in Alzheimer\’s Disease Brain: A New Hypothesis.” Research Gate, July 1999, www.researchgate.net/publication/290949066_Trace_elements_in_Alzheimer\’s_disease_brain_A_new_hypothesis.
[4] Govindaraju, M, et al. “Copper Interactions with DNA of Chromatin and Its Role in Neurodegenerative Disorders.” NeuroImage, Academic Press, 28 Apr. 2013, www.sciencedirect.com/science/article/pii/S2095177913000300.
[5] Ming Chu, T. “2.5: B-Form, A-Form, and Z-Form of DNA.” Biology LibreTexts, Libretexts, 15 Aug. 2020, bio.libretexts.org/Bookshelves/Genetics/Book:_Working_with_Molecular_Genetics_(Hardison)/Unit_I:_Genes,_Nucleic_Acids,_Genomes_and_Chromosomes/2:_Structures_of_Nucleic_Acids/2.5:_B-Form,_A-Form,_and_Z-Form_of_DNA
[6] “Life Sciences and Material Sciences: BIOVIA – Dassault Systèmes.” Life Sciences and Material Sciences | BIOVIA – Dassault Systèmes, www.accelrys.com/.
[7] Anitha S, Jagannatha K.S. Latha K.S. and Viswamitra M.A. First evidence to show the topological change of DNA from B-DNA to Z-DNA conformation in the hippocampus of Alzheimer\’s brain, J Neuromolecular. Med, 2, 287-295. (2002), https://www.ncbi.nlm.nih.gov/pubmed/12622407
[8] Geierstanger B, et al. Base-Specific Binding of Copper(I1) to Z-DNA. THE JOURNAL OF BIOLOGICAL CHEMISTRY , 1991, Base-Specific Binding of Copper(I1) to Z-DNA, https://www.jbc.org/content/266/30/20185.full.pdf
[9] Raiciu, Tudor. “Z-DNA, the Bad DNA.” Softpedia, 13 Feb. 2006, news.softpedia.com/news/Z-DNA-the-Bad-DNA-17947.shtml, https://news.softpedia.com/news/Z-DNA-the-Bad-DNA-17947.shtml
[10] Harris, Edward D. “Copper as a Cofactor and Regulator of Copper,Zinc Superoxide Dismutase.” OUP Academic, Oxford University Press, 1 Mar. 1992, www.academic.oup.com/jn/article-abstract/122/suppl_3/636/4755258?redirectedFrom=PDF
[11] Craig Freudenrich, Ph.D. “How DNA Works.” HowStuffWorks Science, HowStuffWorks, 25 June 2020, science.howstuffworks.com/life/cellular-microscopic/dna4.htm.
[12] Ware, Megan. “Copper: Health Benefits, Recommended Intake, Sources, and Risks.” Medical News Today, MediLexicon International, 23 Oct. 2017, www.medicalnewstoday.com/articles/288165.php
About the Author
High school student who is very passionate about science and is striving to become a doctor. Spent his high school years in Panama studying biology, chemistry, and economics mainly. Apart from studies, he is involved in the school\’s varsity volleyball team and has many other hobbies such as playing video games and reading about new scientific discoveries.
